Blooms of the Moon Jellyfish Aurelia sp.1 medusae have occurred in the harbors and coastal waters of the Bohai and Yellow Seas. However, the occurrence and distribution of Aurelia sp.1 ephyrae is relatively unknown. Mass occurrence of scyphozoan ephyrae in a coastal aquaculture pond (Shidao) in northern China was first recorded in April 2015. Based on morphological characteristics, the ephyrae collected in the aquaculture pond were mostly similar to the ephyrae collected in Atlantic French waters, which were identified as Aurelia sp.1. This was further confirmed by phylogenetic analyses of the mtDNA 16S regions of the sampled ephyrae. Surprisingly, the blooms of Aurelia sp.1 ephyrae formed an obvious reddish color similar to “red tides” in the surface water of the aquaculture pond. The mean density of ephyrae in the reddish color zone of the aquaculture pond was estimated to be 7.38 × 106 individuals m−3. Seawater temperature and wind are the key factors for the formation of Aurelia sp.1 ephyra bloom in the aquaculture pond. Finally, we speculate that artificial structures may provide more substrates for the polyps and enhance the Jellyfish blooms in Chinese aquaculture ponds.

Introduction

Aurelia spp. are the most common scyphozoan Jellyfish with a wide geographic distribution in subtropical, temperate and boreal coastal waters (Lucas, 2001). Blooms of Aurelia sp.1 medusae have been reported in harbors and coastal waters of the Yellow and Bohai Seas and can negatively impact coastal power plant operations, local fisheries and tourism (Dong et al., 2012, 2014; Wan and Zhang, 2012; Wang and Sun, 2015). Multiple environmental factors such as overfishing, eutrophication, climate change, translocation and habitat modification have been proposed as possible causes of Jellyfish blooms (Richardson et al., 2009; Dong et al., 2010; Purcell, 2012; Duarte et al., 2012).

Aurelia sp.1 have a complex life cycle involving asexual polyp and sexual medusa stages. Previous studies suggest that recruitment success during the juvenile (i.e. planula, polyp and ephyra) stages can have a major effect on the abundance of the adult medusa population (Lucas, 2001). Among the juvenile stages, the ephyrae, which link the polyp stage with the medusa stage, also play a significant role in the formation of Aurelia spp. medusa populations. Additionally, measuring the occurrence and distribution of ephyrae may be a practical way to investigate the possible distribution of polyp populations because the ephyrae are released from sessile polyps (Toyokawa et al., 2011). Therefore, the biology and ecology of Aurelia spp. ephyrae is important for understanding the formation and maintenance of Jellyfish blooms. However, scientific knowledge on the occurrence and distribution of Aurelia spp. ephyrae in Chinese coastal waters and the factors determining them remain poorly understood.

A number of researchers suggested that the proliferation of artificial structures in coastal waters might be an important driver of the increase in Jellyfish blooms as an increase in the amount of suitable benthic habitat could lead to polyp proliferation (Duarte et al., 2012; Purcell, 2012; Makabe et al., 2014). For example, polyps of Aurelia spp. have been found in a wide range of artificial substrates off the coasts of Japan, the UK, France and the Mediterranean Sea (Miyake et al., 2002; Ishii and Katsukoshi, 2010; Duarte et al., 2012; Malej et al., 2012). Similarly, a remarkable increase of Aurelia aurita ephyrae occurred after the installation of a floating pier in a fishing port on the Inland Sea of Japan (Makabe et al., 2014). The Aurelia spp. ephyrae mainly occurred in coastal waters of Jiaozhou Bay where artificial structures (including rafts, pontoons, and a cross-sea bridge) have been constructed (Wan and Zhang, 2012; Wang and Sun, 2015).

The provinces of Shandong, Hebei and Liaoning along the coasts of the Bohai and Yellow Seas are major areas for aquaculture of Shrimp, Sea Cucumbers, and edible Jellyfish; they comprise approximately 203 thousand hectares of coastal area in total (Bureau of Fisheries, 2012). The expansion of aquaculture ponds in the coastal area may provide more suitable benthic habitat for Jellyfish polyps, because artificial structures were widely used in the coastal aquaculture ponds (Yang et al., 2015). In the previous study, we observed a mass occurrence of juvenile A. aurita medasae in a nearshore sea cucumber culture pond in Yantai during June 2012 with a mean density of 15.9 medusae m−3 (Dong et al., 2014). In April 2015, a bloom of scyphozoan ephyrae was found incidentally during a field survey of coastal aquaculture in the Shandong province, Northern China. However, the scyphozoan ephyrae were not easily distinguishable because few studies have been conducted on the taxonomy of the scyphozoan ephyrae (Straehler-Pohl and Jarm, 2010; Gambill and Jarms, 2014). In the preset article, the scyphozoan ephyrae were identified based on combined morphological and molecular genetic analyses. In addition, the possible causes for the ephyra bloom in the aquaculture pond were also discussed. To our knowledge, this is the first confirmation of a scyphozoan ephyra bloom in the coastal aquaculture ponds.

Materials and methods

Samples

In April 2015, field surveys were conducted to investigate the coastal aquaculture in the Shandong Province, northern China. The mass occurrence of the scyphozoan ephyrae was recorded in a coastal aquaculture pond of Shidao (SD), which was used for sea cucumber (Apostichopus japonicus) aquaculture (Table 1). The ephyra specimens were stored in 4% buffered formaldehyde-seawater solution. In addition, three specimens of ephyrae were also collected and preserved in pure alcohol for molecular genetic analysis.

The scyphozoan ephyrae in the SD aquaculture pond formed obvious reddish color surface water, which was similar to “red tides” (Figures 1a and b). The densely distributed area of the scyphozoan ephyrae is approximately 150 meters long, 2 meters wide and 0.2 meter deep (Figures 1a and b). The density of the scyphozoan ephyrae in the Shidao aquaculture pond was also estimated. Because the bloom of the scyphozoan ephyrae was found incidentally, it is impossible to sample the ephyrae using plankton net. Three replicate samples were collected along the ephyra zone at distances of 50 meters using 50 ml plastic bottles. In the laboratory, the number of the scyphozoan ephyrae were counted and recorded.

The seawater temperature and salinity were measured in situ with a YSI-600 multi-parameter water quality sonde (YSI, Yellow Springs, OH). Seawater samples for the determination of chlorophyll a (Chl a) concentrations and nutrients were taken from surface waters with three 0.5 L plastic bottles. Chlorophyll a concentrations were determined using UV-VIS spectrophotometer (TU-1810, Beijing Purkinje General Instrument Co., Ltd., China) after filtration on GF/F membranes (Whatman) (Lorenzen, 1967). Nutrients concentrations, including NO3, NO2, NH4+, PO43−, and SiO43+, were determined using Flow Injection Analysis (AA3, Bran+Luebbe, German). The wind speed and direction data were obtained from the Shidao weather station (National Meteorological Information Center, China Meteorological Administration).

Morphological examinations

In total, 147 ephyrae collected in the SD aquaculture pond on 25 April were measured (Table 1). Morphometric measurements including the central disc diameter (CDD), the lappet stem length (LStL), and the rhopalial lappet length (RLL) were taken following the methods developed by Straehler-Pohl and Jarms (2010) and Gambill and Jarms (2014). All of the ephyrae were photographed and measured using an Olympus SZX10 stereo microscope fitted with an Optec TP510 digital camera.

Molecular genetic analyses

Total genomic DNA was extracted from the ephyrae using the TIANamp Marine Animals DNA Kit (TIANGEN, Beijing, China) following the manufacturer's protocol. The mitochondrial 16S fragments were amplified using the universal primers 16S-L (GACTGTTTACCAAAAACATA) and 16S-H (CATAATTCAACATCGAGG) under the PCR conditions previously described (Ender and Schierwater, 2003). The PCR reactions were carried out in a volume of 50 μL that consisted of 50–100 ng genomic DNA, 1 × PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.25 mM primers, and 2.5 U Taq DNA polymerase (TIANGEN, China). The temperature profile was defined as follows: 5 cycles of denaturation at 94°C for 60 s, annealing at 45°C for 50 s and extension at 72°C for 60 s; 30 cycles of denaturation at 94°C for 50 s, annealing at 50°C for 60 s and extension at 72°C for 60 s; this was followed by a final extension at 72°C for 5 min. The PCR products were analyzed by 1.0% agarose gel electrophoresis according to a standard method.

PCR-amplified DNA fragments were purified and sequenced with an ABI 3730 automatic DNA sequencer at Sangon Biotech Co., Ltd (Shanghai, China) using the primers described above. All PCR products were sequenced in both directions to obtain accurate sequences. The DNA sequence fragments were verified, edited and assembled with BioEdit 7.0 (Hall, 2005). The sequences were blasted in NCBI to confirm their identities. Additionally, related Aurelia spp. sequences were obtained from GenBank for phylogenetic analyses. Neighbor joining analysis of 16S data was performed using the K80 model with 1000 bootstrap replicates. Phylogenetic analyses were conducted with MEGA 5.0 (Ballard and Melvin, 2010).

Results

Morphological analysis

All of the ephyrae collected in the SD coastal aquaculture pond have 16 bread knife-like rhopalial lappets with spade-like rhopalial canals (Figures 1c and d). The color of the ephyrae collected in the SD coastal aquaculture pond was reddish brown (Figures 1c and d). The CDD of the specimens in SD were on average 1.30 ± 0.20 mm (mean ± SD; N = 147). The LStL of the specimens in SD were on average 0.57 ± 0.10 mm (mean ± SD; N = 147). The RLL of the specimens in SD were on average 0.38 ± 0.06 mm (mean ± SD; N = 147). The ephyrae collected in SD exhibit ratios of RLL to LStL of 64%.

Molecular genetic analysis

The three partial sequences of mitochondrial 16S rDNA genes were 506 bp in length (GenBank Accession numbers: KX827340 to KX827342). A BLAST search of the GenBank database revealed that all of the mtDNA 16S sequences determined in our study closely matched those of Aurelia sp.1 16S sequences from Jiaozhou bay in Qingdao (JX845344) and the coastal waters of Inchon, Korea (HQ694729; Park et al., 2012). Phylogenetic analysis of aligned mtDNA 16S sequences indicated that all of the ephyrae sampled here were closely related to Aurelia sp.1; this was supported by 100% bootstrap value in NJ trees (Figure 2).

Occurrence of ephyrae

During the sampling time, the seawater temperature was 13.2°C and the salinity was 31.5 in the SD aquaculture pond on 25 April 2015 (Table 1). The mean Chl a concentration was 0.67 ± 0.02 μg l−1 (mean ± SD; N = 3; Table 1). The dissolved inorganic nitrogen (DIN), dissolved inorganic phosphate (DIP) and dissolved silicate (DSi) concentrations were 3.21 ± 1.50 μM, 0.16 ± 0.00 μM, 0.85 ± 0.31 μM, respectively (mean ± SD; N = 3; Table 1). Winds were predominantly southwesterly, with an average wind speed of 14 m s−1.

The Aurelia sp.1 ephyrae were aggregated in the northeast corner of the aquaculture pond. Random sampling of pond bottoms at 50-meter intervals revealed an extremely high density of the ephyrae; 68, 187 and 853 individuals of ephyrae were counted in the three 50-ml bottles. The mean density could be up to 7.38 × 106 individuals m−3 in the mass occurrence zone in the SD aquaculture pond.

Discussion

Based on the face-to-face interviews with farmers, blooms of the scyphozoan ephyrae in the SD aquaculture pond firstly occurred 5 years ago. However, the species most likely accountable for the blooms remains unclear. A previous study suggests that the shape of the rhopalial lappet is an important characteristic for distinguishing ephyrae of the scyphozoan Jellyfish (Grondahl and Hernroth, 1987; Gambill and Jarms, 2014). The Aurelia spp. ephyrae have two forms of the rhopalial lappets: bread knife-like or lancet-like rhopalial lappets. The color of the ephyrae in the genus Aurelia ranged from translucent white to translucent pink to reddish yellow (Straehler-Pohl and Jarm, 2010; Gambill and Jarms, 2014). Therefore, the scyphozoan ephyrae collected in the SD coastal aquaculture pond were initially identified as the Aurelia spp. ephyrae. According to the ratios of RLL to LStL (64%), the ephyrae collected in the SD coastal aquaculture pond are most similar to the Aurelia spp. ephyrae from Atlantic French population (60%) (Table 1; Gambill and Jarms, 2014). In contrast, Aurelia spp. ephyrae from other geographic locations show ratios of RLL to LStL of approximately 50% (Gambill and Jarms, 2014). Based on the above characteristics, the ephyrae collected in the SD coastal aquaculture pond were most similar to the ephyrae collected in Atlantic French waters that were identified as Aurelia sp.1 (Gambill and Jarms, 2014).

Although the mtDNA COI region has been used as a DNA barcode for the Medusozoa (Ortman et al., 2010), the mtDNA 16S sequence was also used to identify the blooming Jellyfish in the northeast Atlantic and Mediterranean (Licandro et al., 2010). In the present study, the mtDNA 16S regions were used for the phylogenetic analyses. Our results confirmed that the sampled ephyrae in the SD coastal aquaculture pond were Aurelia sp. 1. Recently, a molecular analysis of Aurelia spp. medusae from six geographical sites along the Bohai and Yellow Seas confirmed that the Moon Jellyfish in Chinese coastal waters were Aurelia sp.1 (Dong et al., 2015). Therefore, the ephyrae distribution in the SD aquaculture pond is consistent with the adult Moon Jellyfish in Chinese coastal waters.

The distribution of the early life stages of Jellyfish in nature is less known than their adult medusae. Previous studies suggest that the Aurelia sp. ephyrae mainly occur in harbors or inshore waters because there is more substrate for scyphozoan polyps (Toyokawa et al., 2011; Makabe et al., 2014; Wang and Sun, 2015; Makabe et al., 2015). For example, the ephyrae were mostly distributed in fishing ports in Mikawa Bay, Japan (Toyokawa et al., 2011). A remarkable increase of Aurelia aurita ephyrae has been reported following the installation of a floating pier in a fishing port on the Inland Sea of Japan (Makabe et al., 2014). A spatiotemporal dispersion process of A. aurita ephyrae from six ports to offshore waters of northern Harima Nada has been revealed in the Inland Sea of Japan (Makabe et al., 2015). The distribution of ephyrae was mainly restricted to the coastal area of Jiaozhou Bay (Wang and Sun, 2015). However, relatively few ephyrae were collected in the previous study in comparison with adult Jellyfish. For example, a total of 37 ephyrae were collected from the 688.9 m3 in Mikawa Bay, Japan in 2008 (Toyokawa et al., 2011). A total of 56 ephyrae were collected in Jiaozhou Bay in 2011 (Wang and Sun, 2015). It is surprising that extremely high densities of Aurelia sp.1 ephyrae occurred in a Chinese coastal aquaculture pond.

Previous study revealed that seawater temperature was a critical factor controlling the strobilation of Aurelia aurita polyps (Lucas, 2001; Pascual et al., 2015; Wang and Li, 2015). Increased seawater temperature during early springs can trigger the strobilation of Aurelia sp.1 polyps in Chinese coastal waters. For example, Wang and Li (2015) showed Aurelia sp.1 strobilation occurred from 8°C to 17°C and 13°C were the optimal temperature for the ephyra production. In our present study, the seawater temperature recorded during the ephyra bloom was most suitable for the production of Aurelia sp.1 ephyrae. Meanwhile, analysis of the local wind systems indicated a relationship between the distribution of ephyrae and wind directions. Strong southwesterly winds were responsible for aggregations of the Aurelia sp.1 ephyrae in the northeast corner of the aquaculture pond.

Despite the lack of information on the occurrence and distribution of Aurelia sp.1 polyps, high densities of ephyrae in the coastal pond suggested that they could be the site of potential breeding places. Artificial constructions made of concrete, artificial reefs made of tiles, bricks, lantern nets and plastic are widely used in sea cucumber culture ponds (Yang et al., 2015). Previous studies suggest that planulae of Aurelia spp. preferentially settled on artificial substrates (Holst and Jarms 2007; Hoover and Purcell 2009; Duarte et al., 2012). Therefore, artificial structures may provide more substrates for settlement of planulae and asexual reproduction of polyps. Therefore, we speculate that the increased artificial structures may provide more suitable surface for the Aurelia sp.1 polyps. Future field survey regarding the occurrence of Aurelia sp.1 polyps are needed to address this issue.

Conclusions

In conclusion, an extremely high density of scyphozoan ephyrae in a Chinese coastal aquaculture pond was first reported in our present study. Based on morphological and molecular genetics analyses, our results reveal that the scyphozoan ephyrae collected in the aquaculture pond were characterized as a single cryptic species, Aurelia sp.1. Seawater temperature and wind are the key factors for the formation of Aurelia sp.1 ephyra bloom in the aquaculture pond. Further studies are needed to investigate the distribution, causes and influence of Aurelia sp.1 blooms in Chinese coastal aquaculture ponds.

Funding

This work was supported by the grants from the National Natural Science Foundation of China (No. 41206086; No. 41576152) and Strategic Priority Research Program of Chinese Academy of Sciences (No. XDA05130703).

References

Ballard, J.W.O., Melvin, R.G.,
2010
.
Linking the mitochondrial genotype to the organismal phenotype
.
Molecular Ecology
19
,
1523
1539
.
Bureau of Fisheries
,
2012
.
China Fisheries Statistics Yearbook
.
Beijing, China
.
Dong, Z., Liu, D., Keesing, J.K.,
2010
.
Jellyfish blooms in China: dominant species, causes and consequences
.
Marine Pollution Bulletin
60
,
954
963
.
Dong, Z., Liu, D., Wang, Y., Di, B., Song, X., Shi, Y.,
2012
.
A report on a Moon Jellyfish Aurelia aurita bloom in Sishili Bay, Northern Yellow Sea of China in 2009
.
Aquatic Ecosystem Health and Management
15
(2),
161
167
.
Dong, Z., Liu, D., Keesing, J.K.,
2014
. Contrasting Trends in Populations of Rhopilema esculentum and Aurelia aurita in Chinese Waters. In K. Pitt, C. Lucas (Eds.),
Jellyfish blooms
, pp.
207
218
,
Springer-Verlag
,
Berlin
.
Dong, Z., Liu, Z., Liu, D.,
2015
.
Genetic characterization of the scyphozoan jellyfish Aurelia spp. in Chinese coastal waters using mitochondrial markers
.
Biochemical Systematics and Ecology
60
,
15
23
.
Duarte, C.M., Pitt, K.A., Lucas, C.H., Purcell, J.E., Uye, S.I., Robinson, K., Brotz, L., Decker, M.B., Sutherland, K.R., Malej, A., Madin, L., Mianzan, H., Gili, J.M., Fuentes, V., Atienza, D., Pagés, F., Breitburg, D., Malek, J., Graham, W.M., Condon, R.H.,
2012
.
Is global ocean sprawl a cause of jellyfish blooms?
Frontiers in Ecology and Evolution
11
,
91
97
.
Ender, A., Schierwater, B.,
2003
.
Placozoa are not derived cnidarians: evidence from molecular morphology
.
Molecular Biology and Evolution
20
,
130
134
.
Gambill, M., Jarms, G.,
2014
.
Can Aurelia (Cnidaria, Scyphozoa) species be differentiated by comparing their scyphistomae and ephyrae?
European Journal of Taxonomy
107
,
1
23
.
Hall, T.,
2005
.
Bioedit 7.0.5
.
Department of Microbiology, North Carolina State University
.
Holst, S., Jarms, G.,
2007
.
Substrate choice and settlement preferences of planula larvae of five Scyphozoa (Cnidaria) from German Bight, North Sea
.
Marine Biology
151
,
863
71
.
Hoover, R.A., Purcell, J.E.,
2009
.
Substrate preferences of scyphozoan Aurelia labiate polyps among common dock-building materials
.
Hydrobiologia
616
,
259
67
.
Ishii, H., Katsukoshi, K.,
2010
.
Seasonal and vertical distribution of Aurelia aurita polyps on a pylon in the innermost part of Tokyo Bay
.
Journal of Oceanography
66
,
329
336
.
Licandro, P., Conway, D., Yahia, M., De Puelles, M., Gasparini, S., Hecq, J., Tranter, P., Kirby, R.,
2010
.
A blooming jellyfish in the northeast Atlantic and Mediterranean
.
Biology Letters
p.
rsbl20100150
.
Lorenzen, C.J.,
1967
.
Determination of chlorophyll and pheo-pigments: spectrophoto-metric equations
.
Limnology and Oceanography
12
,
243
.
Lucas, C.H.,
2001
.
Reproduction and life history strategies of the common jellyfish, Aurelia aurita, in relation to its ambient environment
.
Hydrobiologia
451
,
229
246
.
Makabe, R., Furukawa, R., Takao, M., Uye, S.,
2014
.
Marine artificial structures as amplifiers of Aurelia aurita s.l. blooms: a case study of a newly installed floating pier
.
Journal of Oceanography
70
,
447
455
.
Makabe, R., Takeoka, H., Uye, S.,
2015
.
Offshore dispersion of ephyrae and medusae of Aurelia aurita s.l. (Cnidaria: Scyphozoa) from port enclosures: Physical and biological factors
.
Journal of Marine Systems
152
,
75
82
.
Malej, A., Kogovsek, T., Ramsak, A., Catenacci, L.,
2012
.
Blooms and population dynamics of Moon Jellyfish in the northern Adriatic
.
Cahiers De Biologie Marine
53
,
337
342
.
Miyake, H., Terazaki, M., Kakinuma, Y.,
2002
.
On the Polyps of the Common Jellyfish Aurelia aurita in Kagoshima Bay
.
Journal of Oceanography
58
,
451
459
.
Ortman, B., Bucklin, A., Pagès, F., Youngbluth, M.,
2010
.
DNA Barcoding the Medusozoa using mtCOI
.
Deep Sea Research Part II: Topical Studies in Oceanography
57
,
2148
2156
.
Park, E., Hwang, D.S., Lee, J.S., Song, J.I., Seo, T.K., Won, Y.J.,
2012
.
Estimation of divergence times in cnidarian evolution based on mitochondrial protein-coding genes and the fossil record
.
Molecular Phylogenetics and Evolution
62
,
329
345
.
Pascual, M., Fuentes, V., Canepa, A., Atienza, D., Gili, J.M., Purcell, J.E.,
2015
.
Temperature effects on asexual reproduction of the scyphozoan Aurelia aurita sl: differences between exotic (Baltic and Red seas) and native (Mediterranean Sea) populations
.
Marine Ecology
36
,
994
1002
.
Purcell, J.E.,
2012
.
Jellyfish and ctenophore blooms coincide with human proliferations and environmental perturbations
.
Annual Review of Marine Science
4
,
209
235
.
Richardson, A.J., Bakun, A., Hays, G.C., Gibbons, M.J.,
2009
.
The jellyfish joyride: causes, consequences and management responses to a more gelatinous future
.
Trends in Ecology and Evolution
24
,
312
322
.
Straehler-Pohl, I., Jarms, G.,
2010
.
Identification key for young ephyrae: a first step for early detection of jellyfish blooms
.
Hydrobiologia
645
,
3
21
.
Toyokawa, M., Aoki, K., Yamada, S., Yasuda, A., Murata, Y., Kikuchi, T.,
2011
.
Distribution of ephyrae and polyps of jellyfish Aurelia aurita (Linnaeus 1758) sensu lato in Mikawa Bay, Japan
.
Journal of Oceanography
67
,
209
218
.
Wan, A., Zhang, G.,
2012
.
Annual occurrence of moon jellyfish Aurelia sp.1 in the Jiaozhou Bay and its impacts on zooplankton community
.
Oceanlogia ET Limnologia Sinica
43
,
494
501
. (
In Chinese
)
Wang, N., Li, C.,
2015
.
The effect of temperature and food supply on the growth and ontogeny of Aurelia sp. 1 ephyrae
.
Hydrobiologia
754
,
157
167
.
Wang, Y., Sun, S.,
2015
.
Population dynamics of Aurelia sp.1 ephyrae and medusa in Jiaozhou Bay, China
.
Hydrobiologia
754
,
147
155
.
Yang, H., Hamel, J., Mercier A.,
2015
.
The sea cucumber Apostichopus japonicus: History, biology, and aquaculture
.
Academic Press, Elsevier
.